Google Translate

Uji MIC, Uji Patogenisitas dan Isolasi Genom (Metode CTAB)


Mikrob target diremajakan kembali untuk digunakan dalam uji Minimum Inhibitory Concentration (MIC). Mikrob target ini juga dibiakkan dalam media NB dan diinkubasi selama 24 jam pada suhu  ruang.
     Isolat bakteri filosfer penghasil antimikrob yang telah diinkubasi kemudian disentrifugasi dengan kecepatan 10000 rpm selama 30 menit. Supernatan yang diambil hasil sentrifugasi dimasukkan kedalam 5 tabung reaksi dengan konsentrasi yang berbeda-beda masing-masing 6,25%, 12,5%, 25%, 50%, dan 100%. Setelah itu, masing-masing tabung diisi dengan 1 ml bakteri target. Biakan uji MIC tersebut lalu diinkubasi selama 24 jam. Kemudian diamati kekeruhan masing-masing biakan di dalam tabung reaksi. MIC ditentukan berdasarkan kekeruhan biakan.
Uji Patogenisitas
     Permukaan media agar darah digoreskan isolat bakteri filosfer. Setelah itu diinkubasi selama 24 jam, lalu diamati ada atau tidaknya zona bening. Isolat yang disekitarnya terdapat zona bening berarti bersifat patogen.
Isolasi Genom (Metode CTAB)
Sebanyak 1.5 ml kultur bakteri disentrifugasi 10000 rpm selama 10 menit. Pelet diresuspensi menggunakan bufer TAE 1x dan disentrifugasi kembali. Sebanyak 5 µl lisozim ditambahkan kedalam suspensi, kemudian diinkubasi pada suhu 37 0C selama 30 menit. SDS 10% sebanyak 500 µl ditambahkan kedalam campuran, inkubasi dilakukan selama 60 menit pada suhu 37 0C. Sebanyak 100 µl CTAB 10% dan 80 µl NaCl 5M ditambahkan lalu diinkubasi selama 20 menit pada suhu 650C. Pemisahan DNA dari molekul organik lainnya dilakukan dengan penambahan 650 µl PCI (suspensi di vorteks), kemudian campuran disentrifugasi 12000 rpm selama 10 menit, lapisan atas pada tabung mikro dipindahkan ke tabung mikro yang baru lalu ditambahkan 650 µl larutan CI. Campuran disentrifugasi 12000 rpm selama 10 menit. Lapisan atas dipindahkan ke tabung mikro baru dan ditambah etanol absolut sebanyak 2x volume larutan suspensi DNA. Inkubasi dilakukan 12 jam pada suhu     -20 0C untuk mengendapkan DNA. Setelah 12 jam, suspensi disentrifugasi 12000 rpm selama 10 menit. Pelet DNA dibilas dengan etanol 70%. Kemudian pelet dibiarkan kering udara selama 12 jam. Setelah kering pelet DNA diresuspensi dengan 20 µl ddH2O steril. Visualisasi isolasi DNA Genom dilakukan dengan metode elektroforesis pada gel agarosa.
Amplifikasi Gen Pengkode 16s-rRNA dengan Teknik Polymerase Chain Reaction (PCR)
     Reaksi PCR untuk mengamplifikasi 16s-rDNA dilakukan dengan mencampurkan 12.5 bufer PCR GC II, 4 µl dNTPs (2.5 mM/dNTP), 1 µl primer 63 f (CAGGCCTAACACATGCAAGTC) (5 nm), 1 µl primer 1387 r (GGGCGGWGTGTACAAGGC) (5 nm), 4 µl DNA cetakan, dan 0.25 µl (5 unit/µl) enzim Taq DNA polymerase (TAKARA) dan 2.25 µl ddH2O hingga volume reaksi PCR menjadi 25 µl. Reaksi PCR dilakukan sebanyak 30 siklus dengan masing-masing tahap yaitu: 1. Predenaturasi (94 0C, 5 menit); 2. Denaturasi (94 0C, 1 menit); 3. Annealing (55 0C, 1 menit); 4. Polimerisasi (72 0C, 1 menit). Post PCR dilakukan pada suhu 72 0C selama 2 menit.   Visualisasi amplikon 16s-rDNA, pks dan nrps dilakukan melalui elektroforesis.
     Hasil amplifikasi gen PCR ini kemudian disekuen untuk mengetahui susunan basa pada DNA bakteri. Susunan basa DNA tersebut lalu dianalisis bioinformatik untuk mengidentifikasi jenis bakteri filosfer reundeu. Setelah diketahui spesies bakteri filosfer reundeu, selanjutnya dianalisis kekerabatannya dengan membuat pohon filogenetik.

Tidak ada komentar:

Baca Juga Artikel Yang Lainnya:

·